Ptf1a-creert2
Web036577 B6.129S6(Cg)- Ptf1a tm2(cre/ESR1)Cvw /J The Ptf1a Cre-ERTM knock-in allele was designed to both abolish pancreas specific transcription factor, 1a ( Ptf1a ) gene function and express CreERTM fusion protein from the Ptf1a promoter/enhancer elements. PTF1A effects growth and lineage specification of pancreatic multipotent progenitor cells during … WebPtf1a F TCA CAT GTG TTT CTA TAA GCT GTT TG. WT = 250 bp mut = 350 bp Ptf1a R ATA CCA GCA GGT TGT TAT CTA GAG Ptf1a Null F1 GGGTCAAATCCAATATTCTC Null = ~320bp Ptf1a Null R1 AGGTTGTTATCTAGAGCCAG Isl1-Flox F1 TCT CTC ATT GGG GAA GCA AC WT=411 bp Flox=513 bp Isl1-Flox R1 TCC AGT GAA GGC CTT CC AGT Null = ~500bp Isl1 …
Ptf1a-creert2
Did you know?
WebPtf1a is preferably assembled into a transcription trimeric complex PTF1 with an E protein and Rbpj (or Rbpjl). In pancreatic development, Ptf1a is indispensable in controlling the … WebTgBAC(ptf1a:Cre-ERT2) ID ZDB-TGCONSTRCT-151008-6 Name TgBAC(ptf1a:Cre-ERT2) Previous Names. tg(ptf1a:creERT2) Type engineered_plasmid Regulatory Regions. ptf1a ; …
WebNumbers of Ptf1a + Sox9 + cells decreased rapidly as organogenesis progressed. (P) Schematic, lineage potency of Ptf1a + Sox9 + Hnf1 + tip MPC during the 2° transition. Scale bars: 50 mm. from ... WebJun 17, 2024 · More specific lineage tracing analysis showed that acinar specific Ptf1a CreERT2 Kras G12D Arid1a f/f mice developed PanINs but not IPMNs after tamoxifen injection. In comparison , while oncogenic Kras G12D in adult ductal cells ( Hnf1 CreERT2 Kras G12D ) alone did not induce any sign of ductal atypia, Hnf1 CreERT2 Kras G12D …
WebAs predicted, PTF1a induced gene expression of digestive enzymes and acinar-specific transcription factors, while MIST1 induced gene expression of vesicle trafficking … WebJan 31, 2024 · We believe that these differences are due to the difference of Cre-inducing mouse used for Hes1 ablation, i.e., Elastase1-CreERT2 mice in our work and Ptf1a-Cre in …
WebThe results confirm the presence of multipotent ptf1a‐expressing progenitor cells in developing zebrafish pancreas, with reduced pTF1a dosage promoting greater …
WebJul 7, 2015 · The protein PTF1A is crucial for establishing the differentiation state of acinar cells. In the most common form of pancreatic cancer, acinar cells are reprogrammed to … sand blowing in the windhttp://en.modelorg.com/upload/pdf/Ptf1a-CreERT2.en-us.pdf s and b motorsWebPlasmid p-EF1a-CreERT2-3Xflag-T2A-eBFP2 from Dr. Bradley Bernstein's lab contains the insert CreERT2-T2A-eBFP2 and is published in Cell Rep. 2024 Oct 6;33(1):108222. doi: … sand blowing truckWebJan 1, 2024 · Ptf1a CreERTM, 16 CK19 CreERT2, 17 Sox9-CreERT2, 23 LSL-Kras G12D, 15 and R26R EYFP 18 mice have been described previously. Cre-mediated recombination … sand blue hexWebCurrent Weather. 4:15 AM. 38° F. RealFeel® 31°. Air Quality Fair. Wind SW 9 mph. Wind Gusts 9 mph. Clear More Details. s and b motorsportWeb15 NIGHT GREENLAND CRUISE. Departs From Boston, Massachusetts. Onboard Grandeur of the Seas. From USD*. $ 1,401. view 1 date. 4 NIGHT CANADA CRUISE. Departs From … s and b minisWebPtf1a(P48)-Cre driver mouse allele32 –34,55 60. Pdx1 is not a ... CreERT2, proCPA1-CreERT2, or Ela-CreERT2 mouse alleles also shows PanIN development with focal cystic neoplasia33,61. On the s and b motors edgware